Site Loader

Polymorphisms in the cistrons encoding enzymes in the folate-mediated one-carbon metamorphosis tract have been implicated as maternal hazard factors for giving rise to Down syndrome but consequences have been observed to change with different populations and ethnicity. The SNPs in two cardinal enzymes, one each of folate-dependent and folate-independent tracts were evaluated as hazard factors for giving rise to babes with Down syndrome. The frequence of the MTHFR 677C & gt ; T and BHMT 742G & gt ; A polymorphisms was analysed in an Indian cohort dwelling of 102 case-mothers and 98 control-mothers. The frequence of the variant ‘T ‘ allelomorph for the MTHFR SNP was 0.11 in case-mothers and 0.14 in control-mothers. The frequence of the variant ‘A ‘ allelomorph for the BHMT SNP was 0.30 in case-mothers and 0.28 in control-mothers. Since the frequences did non differ significantly, our findings did non back up the association of the SNPS with the hazard of Down syndrome in Indian population.

Cardinal words: Down syndrome, polymorphisms, one-carbon metamorphosis, MTHFR, BHMT


The most common signifier of aneuploidy sufficiently feasible to last to term in comparatively big Numberss is Down syndrome ( DS ) [ Cuckle, 2005 ] . DS is a type of birth defect associated with chromosomal abnormalcy ( excess transcript of chromosome 21 ) in the affected kids. A inborn upset, it is the most common cause of mental deceleration [ James et al. , 1999 ] . The association between DS and a 3rd transcript of chromosome 21 was discovered in 1959 but the molecular footing is still ill-defined [ Lejeune et al. , 1959 ] . Meiotic non-disjunction ( unnatural segregation of chromosomes during miosis ) ensuing in disomic maternal gamete ( ovum ) more than 90 % of the clip, has been addressed as the pocause for the excess transcript of chromosome 21 [ James et al. , 1999 ] . Fertilization of an unnatural ( disomic ) maternal gamete with normal ( monosomic ) paternal gamete gives rise to three transcripts of chromosome 21 – i.e. chromosome 21 trisomy in the foetus [ Saenz, 1999 ] . The extra familial stuff arising as a consequence of a 3rd transcript of chromosome 21 has a profound consequence on multiple systems and leads to mental deceleration and a host of deformities such as inborn bosom disease, thyroid disease, loss of hearing, opthalmological anomalousnesss amongst others [ Antonarakis and Epstein, 2006 ; Committee on Genetics, 2001 ; Bromham et al. , 2002 ] . The incidence of DS is ~1 in 600 to 1 in 1,000 unrecorded births [ Hobbs et al. , 2000 ] . In the Indian population, the prevalence of DS was 0.98 per 1,000 harmonizing to the informations obtained from the National Neonatal – Perinatal Database, 1995 ( India ) [ NNPD, 1997 ] whereas regional surveies carried out in some parts of India saw a prevalence scope of 0.66 to 1.17 per 1,000 [ Bharucha, 1998 ; Verma et al. , 1998 ; Modi et al. , 1998 ; Isaac et al. , 1985 ] .

The complexnesss associated with this birth defect are immense, by and big and unravelling of the enigma is of critical importance taking into consideration that there is no medical remedy. The strongest epidemiological variable linked to DS is advanced maternal age [ Cuckle, 2005 ] . But, of late kids with DS are born to immature female parents.

One-carbon metamorphosis

Vitamin bcs play an of import function in the credence and the transportation of one-carbon units in the synthesis of thymidylate and purines, aminic acerb inter-conversions including transition of serine to glycine, methionine regeneration by remethylation of homocysteine, katabolism of histidine, and the formation of S-adenosylmethionine ( SAM ) – the primary methylating agent in the organic structure required for many biological methylation reactions [ Gregory, 2001 ; Lucock et al. , 2005 ] .

The captive vitamin Bc from the diet ( monoglutamate form- folic acid ) gets reduced to 5, 6, 7, 8-tetrahydrofolate ( THF ) via 7, 8-dihydrofolate ( DHF ) by the enzyme dihydrofolate reductase, and subsequently to 5,10-methylene THF and finally to 5-methyl THF [ Figueiredo et al. , 2008 ] . The irreversible decrease of 5, 10-methylene THF to 5-methyl THF is brought approximately by the flavin A dinucleotide ( FAD ) -dependent 5,10-methylene tetrahydrofolate reductase enzyme ( MTHFR, EC ) . The merchandise ensuing from the MTHFR enzyme activity ; 5-methylTHF is the methyl giver in the remethylation of homocysteine to methionine catalyzed by vitamin B12-dependent methionine synthase, ( MS ; EC ) [ Hustad et al. , 2007 ] . The remethylation of homocysteine to methionine can take topographic point by both, the folate- dependant and -independent tracts. In the vitamin Bc dependent tract, the activity of 5, 10- methylene tetrahydrofolate reductase leads to the handiness of a methyl group for which is utilized by methionine synthase enzyme for remethylation. In the folate independent tract, the methyl group is donated by betaine, in a reaction catalyzed by betaine homocysteine methyltransferase ( BHMT ; EC ) [ district attorney Costa et al. , 2006 ] . After donating the methyl group for the remethylation of homocysteine, betaine gets transformed into dimethylglycine [ Forges, 2007 ] . The dimethylglycine so formed, gets oxidized to organize glycine. This leads to the debut of one – C units into the folate pool that stimulates the vitamin Bc – dependent homocysteine remethylation, therefore ensuing in reduced homocysteine degrees [ Heil, 2000 ] . Methionine formed by remethylation of homocysteine so gets converted into S – Adenosyl Methionine ( SAM ) by accepting adenosine from ATP molecule in a reaction catalyzed by methionine adenosyl transferase [ Lucock et al. , 2005 ] . SAM donates the methyl group during the assorted methylation reactions, catalyzed by specific methyltransferases, and so signifiers S-adenosyl homocysteine ( SAH ) . SAH gets hydrolyzed into homocysteine in a reversible reaction. Homocysteine may undergo trans-sulphuration to give rise to cystathionine or it may undergo remethylation to organize methionine [ Steegers-Theunissen, 1995 ] .

SAM is involved in methylation of C residues in DNA. DNA methylation makes a cistron transcriptionally inactive. Therefore, cistron look is controlled by DNA methylation. When there is dietetic folate lack and/or reduced activity of MTHFR enzyme, the coevals of SAM is limited. This may ensue in DNA hypo-methylation and eventful inappropriate extent of cistron inactivation [ Narayanan et al. , 2004 ] . DNA hypo-methylation has been linked to abnormal chromosomal segregation [ Rosenblatt, 1999 ] that may be a hazard factor for DS-birth. Chromosomal instability and higher homocysteine transsulphuration may be linked to defects in the cistrons involved in one-carbon metamorphosis [ Gueant et al. , 2005 ] .

MTHFR 677C & gt ; T SNP

A 677C & gt ; T passage at the place 677 in the coding DNA 4 on chromosome 1 was identified in the coding part of MTHFR, which resulted in the alteration of an alanine residue, which is extremely conserved, to a valine residue in the enzyme at the place 222. This mutant led to the debut of limitation site for the enzyme Hinf I. The homozygous discrepancy of this cistron showed reduced enzyme activity and increased susceptibleness to heat in vitro [ Frosst et al. , 1995 ] .

The discrepancy ( ‘T ‘ ) allelomorph frequence has shown marked fluctuation harmonizing to the geographic location every bit good as ethnicity ; for illustration, 33.3 % in the Portugal survey [ Castro et al. , 2003 ] , 42 % in Spain [ Guillen et al. , 2001 ] and 43.8 % in Italy [ Botto & A ; Yang, 2000 ] . Among the African- Americans, the mutant was found to be comparatively infrequent [ Stevenson et al. , 1997 ] . In a meta-analysis based on informations obtained from 40 surveies by Klerk and co-workers, the allelomorphic frequences ranged from 3.2 % ( UK Indians ) to 30.2 % ( Italy in 1998 ) [ Klerk et al. , 2002 ] .

James and co-workers hypothesized that the MTHFR mutant would be a predisposing factor for unnatural DNA methylation and lead to a higher hazard of meiotic non-disjunction which was thought to be the major cause of the presence of 3 transcripts in Trisomy 21. Their survey was the first to associate unnatural vitamin Bc metamorphosis and MTHFR 677 C & gt ; T mutant with DS. Positive association of the MTHFR SNP as a hazard factor for giving rise to kids with Down syndrome was obtained in subsequent surveies [ Hobbs et al. , 2000 ; Meguid et al. , 2008 ; Wang et al. , 2007 ] . Nevertheless, negative findings have besides been reported [ Petersen et al. , 2001 ; Stuppia et al. , 2002 ; Yanamandra et al. , 2003 ; Chango et al. , 2005 ; Gueant et al. , 2003 ] .

BHMT 742G & gt ; A SNP

Another polymorphism of involvement was the BHMT 742G & gt ; A SNP. Deficiency of vitamins B12 and vitamin Bc, mild hyperhomocysteinemia, has been reported in several surveies in different parts of India [ Refsum et al. , 2001 ; Chandrasekhar et al. , 1980 ; Vijayalakshmi & A ; Shobana, 1982 ; Balaji & A ; Dustagheer, 2000 ] . In instance vitamin Bc metabolic pathway gets compromised as a consequence of cistron defects or low handiness of micronutrients such as vitamin B12 and vitamin Bc, the folate-independent tract of remethylation of homocysteine would be operational and BHMT would hold a important function to play [ Chiuve et al. , 2007 ; Ananth et al. , 2007 ] . The Guanine to Adenine alteration at the 742 place in exon 6 leads to the replacing of an arginine with a glutamine residue at codon 239 ( R239Q ) in the protein [ Weisberg et al. , 2003 ] . In vitro surveies carried out on the 742G & gt ; A SNP did non happen any differences in thermostability of the enzyme nor any consequence on the plasma homocysteine concentrations [ Weisberg et al. , 2003 ] . BHMT mutant has been later associated with cardiovascular disease [ Weisberg et al. , 2003 ] , placental breaking off [ Ananth et al. , 2007 ] and nervous tubing defects [ Boyles et al. , 2006 ; Morin et al. , 2003 ] . To the best of our cognition, no surveies have been carried out to show the association of the BHMT 742 G & gt ; A SNP with DS. Hence, we decided to analyse it every bit good. Therefore, the primary intent of the survey was to analyze mutants in cistrons coding for cardinal enzymes of both the folate-dependent every bit good as folate-independent tracts ( MTHFR and BHMT ) for the remethylation of homocysteine to methionine as maternal hazard factors for giving birth to kids with DS in the Indian population.

Materials & A ; methods


The survey was approved by the Ethics Committee of Bai Jerbai Wadia Hospital for Children, Mumbai ( B.J.W.H.C. ) . The survey participants ( case-and control-mothers ) were unrelated and of Indian beginning. Registration of all survey participants was made with their written informed consent. The inclusion standards were as follows: ( a ) female parents who had given birth to offspring affected with Down syndrome ( case-mothers ) ( B ) female parents of healthy progeny ( control-mothers ) ( degree Celsius ) a written informed consent to take part in the survey. The exclusion standards included: ( a ) history of major illness- viz. malignant neoplastic disease, renal/liver disease ( B ) engagement in another clinical test within a month of registration in the present survey. A elaborate instance record signifier ( CRF ) was filled out for every participant in the survey. The CRF contained information on demographics, the medical and obstetric/gynaecology history of the female parent, information about her affected every bit good as unaffected kids and any current medicine, and dietetic information utilizing a 24-hour callback and nutrient frequence questionnaire method. The diagnosing of kids affected with DS was done on the footing of their karyotype study and/or clinical marks such as facial characteristics, presence of mental deceleration or inborn bosom disease confirmed by echocardiography. In all instances diagnosing of DS was confirmed by the doctor.


102 case-mothers and 104 control-mothers were enrolled in the survey. The registration of case-mothers was done by sing the wards and OPDs of B.J.W.H.C. , every bit good as run intoing the female parents at particular schools. Out of a sum of 102 case-mothers, 37 were enrolled from Sulbha School for mentally retarded kids ( 36 % ) , 33 at Centre for Research in Mental Retardation ( CREMERE ) ( 32 % ) , 20 at BJWHC ( 20 % ) , 7 at Saraswati Mandir School ( 7 % ) , 4 at K.M.S. Shirodkar School ( 4 % ) and 1 at blood contribution cantonment held in the premises of Larsen and Toubro Ltd. ( 1 % ) . Out of 104 control-mothers, 19 were enrolled at the Institute of Chemical Technology ( Mumbai ) , 17 at Larsen and Toubro ( Mumbai ) ; and the staying at several residential societies: 17 in Borivali, 16 in Ghatkopar, 15 at Worli Dairy, 13 at Nagpada, 4 at Dahisar, 2 in Bandra and 1 in SEC school.

Sample aggregation & A ; processing

8 ml sample of venous blood was withdrawn from each participant in two EDTA tubings. Genomic DNA was extracted from whole blood utilizing salt-extraction method every bit good as utilizing miniprep spin columns ( MB504 HiPurA Blood Genomic DNA MiniPrep Purification Spin Kit-HiMedia, India ) .

Genotype analysis

Genotype analysis of the MTHFR cistron was carried out by polymerase concatenation reaction in a het palpebra thermic cycler ( Progene-Techne, UK ) followed by limitation enzyme digestion of the amplified merchandise with Hinf I utilizing conditions as antecedently established [ Frosst et al. , 1995 ] . For the genotype analysis of the BHMT SNP, PCR was carried out utilizing the primers TGCTGGTTTCTGGTGCATCCCTAA and AAGGGCTGGCTCATCAGGTGAGCTTTGAGT in a het palpebra thermic cycler ( MyCyclera„? – BIO – RAD, USA ) . The elaboration protocol followed was a alteration of the method described elsewhere wherein a concluding extension of 5min, 72A°C was added [ Ananth et al. , 2007 ] . The amplified PCR merchandise of 171-bp was digested overnight at 37oC with Hinf I. The presence of normal G allelomorph established a limitation site, bring forthing 141-bp and 30-bp fragments of whereas the mutant ‘A ‘ allelomorphs abolished the limitation site. The digest was sized on a 3 % agarose gel with ethidium bromide and visualized under UV-light. Genotypes were recorded. The gel was photographed for record utilizing a digital camera ( Canon G5-Canon, Asia ) and a UV cogent evidence goon. Genotype consequences were obtained for all case-mothers but 98 out of 104 control-mothers. This was because 4 control-mothers did non describe for blood aggregation whereas DNA output was hapless for other 2 samples.

Statistical analysis

The allelomorphic and genotypic frequences were determined by direct count. Association of MTHFR and BHMT genotypes between instance and control female parents was estimated by utilizing an odds ratio with 95 % assurance intervals. Mean and standard divergences were presented for the uninterrupted variables. A ‘p ‘ value of 0.05 or less was considered to be important statistically.


The case- and control-mothers were matched for age and part of beginning. They consisted of Maharashtrians, Gujaratis, North Indians and South Indians. The frequence of the variant ‘T ‘ allelomorph of the MTHFR 677C & gt ; T SNP was 0.14 in control-mothers and 0.11 in case-mothers. The frequence of the ‘A ‘ allelomorph of the BHMT 742G & gt ; A SNP was 0.28 in control-mothers and 0.30 in case-mothers. Genotype distribution followed Hardy-Weinberg equilibrium for MTHFR 677C & gt ; T and BHMT 742G & gt ; A SNP ‘s.

The BMI for control-mothers was 25A±4 kg/m2 ( MeanA±SD ) and 24A±5 kg/m2 for case-mothers ( MeanA±SD ) . The average age of the case-mothers at the clip of bringing of a kid with DS was found to be 28A±6 old ages ( MeanA±SD ) . In 38 instances ( 37 % ) , the first born kid had DS, whereas the 2nd born kid with DS was seen in 35 instances ( 34 % ) . A household history of a kid with DS was seen in 12 case-mothers ( 12 % ) . Documents related to DS were obtained in 79 instances ( 77 % ) . Karyotype studies were available for 45 instances ( 4 had mosaic DS whereas the remainder had Trisomy 21 ) . In all instances diagnosing of DS was confirmed by the doctor. The gender of DS kid was found to be male in 64 instances ( 62 % ) and female in 38 instances ( 38 % ) . Premature bringing was seen in 14 instances ( 14 % ) whereas the birth of the DS kid was found to be full term in 88 instances ( 86 % ) . Akin matrimony was seen in 7 case-mothers ( 7 % ) and in 6 control-mothers ( 6 % ) . History of febrility during gestation was reported by 11 % of case-mothers and in 4 % of control-mothers. High blood pressure was reported in 13 case-mothers ( 13 % ) and in 8 control-mothers ( 8 % ) . Type II diabetes mellitus was reported in 3 case-mothers ( 3 % ) and in 5 control-mothers ( 5 % ) . Nine case-mothers ( 9 % ) and 3 control-mothers ( 3 % ) reported on the wont of baccy ingestion ( 97 % ) . Vitamin addendums were reported merely in 2 case-mothers ( 2 % ) and in 10 control-mothers ( 10 % ) . Calcium addendums were reported merely in 7 case-mothers ( 7 % ) and in 23 control-mothers ( 22 % ) .


Made up of more than 4,500 culturally and anthropologically good defined populations with limited cistron flow mediate, India represents the largest human diverseness. India has a population of more than one billion citizens, coupled with a overplus of castes, bomber castes and folks, high grade of intermarriage and blood kinship in assorted religious orders [ Malini & A ; Ramachandra, 2006 ] .

Surveies carried out in Indian population have reported comparatively low frequence of T allelomorph in Indians [ Mukherjee et al. , 2002 ; Devi et al. , 2004 ; Kumar et al. , 2005 ; Refsum et al. , 2001 ; Nair et al. , 2002 ; Angeline et al. , 2004 ] . In the present survey, the homozygous discrepancy genotype ( i.e. ‘TT ‘ genotype ) was present in 2 % control-mothers as against 1 % case-mothers. In a survey on North Indian female parents, the homozygous discrepancy genotype was present in 6 % of control-mothers and absent in case-mothers [ Kohli, et al. , 2003 ] . In the survey on Gujarati adult females, more control-mothers ( 8 % ) had the homozygous discrepancy genotype as compared to the case-mothers ( 4 % ) [ Sheth et al. , 2003 ] but contradictory consequences were reported in a survey in adult females largely from Eastern India where 8 % of case-mothers and 1.2 % of control-mothers had the homozygous discrepancy genotype [ Rai et al. , 2006 ] . Another survey carried out in South India besides reported MTHFR as a hazard factor with T allele frequence of 4 % in case-mothers and 0 % in control-mothers [ Cyril et al. , 2009 ] . In the present survey, the frequence of the variant ‘T ‘ allelomorph for the MTHFR 677C & gt ; T SNP was 0.11 ( 11 % ) for case-mothers and 0.14 ( 14 % ) for control-mothers. In the West Bengal survey, somewhat higher values were reported, with 0.15 ( 15 % ) and 0.16 ( 16 % ) for the case-mothers and control-mothers severally [ Dutta et al. , 2007 ] . It is thought that in a state like India with low degrees of vitamin Bc, low frequence of T allelomorph would be an outgrowth of natural choice [ Rai et al. , 2006 ] .

There is no information on Indian population with regard to the BHMT 742G & gt ; A SNP and maternal hazard of DS. In the present survey, the discrepancy genotype ( ‘AA ‘ genotype ) was similar for case-mothers ( 8 % ) and control-mothers ( 6 % ) . The frequence of the variant ‘A ‘ allelomorph for the BHMT 742G & gt ; A SNP was comparable in case-mothers ( 0.30 ) and control-mothers ( 0.28 ) . The frequence of ‘A ‘ allelomorph of BHMT 742G & gt ; A SNP in a survey on the Indian population carried out at the Foods Department of ICT was 0.25 for controls [ Mukherjee et Al, 2009 ] . Hence the BHMT 742G & gt ; A SNP was non associated as a maternal hazard factor of DS.

A known hazard factor for DS is the age of the female parent above 35 old ages ( advanced maternal age ) . But, merely 17 % of the case-mothers were found to be over 35 old ages of age at the clip of birth of the affected DS kid. Similar low findings ( 8.4 % ) have been reported [ Sheth et al. , 2007 ] . Hence our findings do non back up advanced maternal age as hazard factor for birth of DS kid. Besides, maximal DS kids were eldests in the present survey. Comparable consequences have been reported [ Kaur et al. , 2003 ] .

Consanguinity has been reported to increase the hazard ( 3 % ) of holding kids with inborn deformities [ Sogaard & A ; Vedsted – Jakobsen, 2003 ] . Besides, it has been observed that there is an about four fold addition in DS happening ( p & lt ; 0.005 ) in closely related parents [ Alfi et al. , 1980 ] . An increased DS hazard in South India has besides been linked with blood kinship [ Malini & A ; Ramachandra, 2007 ] . But in the present survey, the frequence of akin matrimony was comparatively low and comparable in both control- and case-mothers, bespeaking small or no association between blood kinship and DS. Similar findings related to blood kinship hold besides been reported [ Hamamy et al. , 1990 ; Basaran et al. , 1992 ; Zlotogora, 1997 ] .

A higher per centum of case-mothers showed history of febrility compared to the control-mothers ( 11 % versus 4 % ) . Though the difference was non statistically important, it could be said that there is a tendency of history of high febrility during gestation in the case-mothers. Therefore, there might be a possibility that history of febrility during gestation may be associated as a hazard factor for DS.

In this survey, an surplus of males were found as compared to females. Higher sex ratio in persons with DS compared to the general population has been observed [ Isaac et al. , 1985 ] . More figure of males has been found among unrecorded – Born and aborted constructs with Trisomy 21 [ Hassold, 1983 ] . Very early choice against female constructs with an excess chromosome 21 as compared to male constructs could be the ground for the males among all clinically recognized trisomy 21 constructs.

Even though the chosen polymorphisms did non look to be linked as possible maternal hazard factor of DS, the association of DNA polymorphisms at different venue in the same or other cistrons can non be ruled out. Another thing to be considered is that there are a big figure of cultural groups in India, and a peculiar determination should non be used to pull any important decision as the gene-pool is extremely conserved. So we hereby urge farther surveies with larger sample sizes with people of different geographic beginning so as to do a better opinion on the association.


Our survey did non back up the association of the MTHFR 677C & gt ; T nor the BHMT 742G & gt ; A SNP ‘s as maternal hazard factors predisposing to babes with DS in the Indian population. Deoxyribonucleic acid polymorphisms at different venue in the same or other cistrons may be associated.


Table 1 MTHFR genotypes and allelomorphs in case-mothers and control-mothers




CC, n ( % )

82 ( 80 )

73 ( 74.5 )

CT, n ( % )

19 ( 19 )

22 ( 23.5 )

TT, n ( % )

1 ( 1 )

2, ( 2 )

‘T ‘ allele frequence



Table 2 BHMT genotypes and allelomorphs in case-mothers and control-mothers




GG, n ( % )

50 ( 49 )

42 ( 43 )

GA, n ( % )

44 ( 43 )

50 ( 51 )

AA, n ( % )

8 ( 8 )

6 ( 6 )

‘A ‘ allele frequence



Post Author: admin